View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_210 (Length: 246)
Name: NF8905A_low_210
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_210 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 15861308 - 15861516
Alignment:
| Q |
20 |
atcaaaattttggatatttctttgaccactattgaggccacatcaactacacatcaccacaatatcaatgatagcacattgattgagttataaatggtgg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15861308 |
atcaaaattttggatatttctttgaccacaatggaggccacatcaactacacatcaccacaatatcaatgatagcacattgattgagttataaatggtgg |
15861407 |
T |
|
| Q |
120 |
acaacttgttaagctagcttctgcactgagctaggacaactcccaaattcgaagtctatcccaagggccgactttctccactccaagtttctaaaaatcc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15861408 |
acaacttgttaagctagcttctgcactgagctaggacaactcccaaattcgaagtctatcctaagggccgactttctccactccaagtttctaaaaatcc |
15861507 |
T |
|
| Q |
220 |
acagatatt |
228 |
Q |
| |
|
||| ||||| |
|
|
| T |
15861508 |
acaaatatt |
15861516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University