View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_211 (Length: 246)
Name: NF8905A_low_211
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_211 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 84
Target Start/End: Complemental strand, 38990787 - 38990706
Alignment:
| Q |
3 |
aaaatcattaatgtttgaataaaatgttgctgatatttctcattgttatacttcttaaataaaaatatgttattacaagttt |
84 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38990787 |
aaaatcattaatgtttaaataaaatgctcctgatatttctcgttgttatacttcttaaataaaaatatgttattacaagttt |
38990706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 243
Target Start/End: Complemental strand, 38990651 - 38990612
Alignment:
| Q |
204 |
tgaactgtgcttctctcaagatctcatgttcgattctctc |
243 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
38990651 |
tgaagtgtgtttctctcaagatctcatgttcgattctctc |
38990612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 201 - 245
Target Start/End: Complemental strand, 19525563 - 19525519
Alignment:
| Q |
201 |
tcttgaactgtgcttctctcaagatctcatgttcgattctctctg |
245 |
Q |
| |
|
||||||| |||| |||||||||||||||| ||||||||| ||||| |
|
|
| T |
19525563 |
tcttgaagtgtgtttctctcaagatctcaggttcgattccctctg |
19525519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University