View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_215 (Length: 245)
Name: NF8905A_low_215
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_215 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 32915155 - 32915366
Alignment:
| Q |
18 |
atcaccaccaccatccttccttctcttgctttgtagctcttcacaaagtacacaggttttttacatacatttgtgattttgactttttcctttacttcat |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32915155 |
atcaccaccaccacccttccttctcttgctttgtagctcttcacaaagtacacaggttttttacatacatttgtgattttgactttttcctttacttcat |
32915254 |
T |
 |
| Q |
118 |
ggggaatcctcctgagaccactgcaacctctggtgagttgggttgccttcagtttttatgatcctattataatttgaaatttcattggttttgctttact |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32915255 |
ggggaatcctcctgaggccactgcaacctctggtgagttgggctgccttcagtttttttgatcctattataatttgaaatttcattggttttgctttact |
32915354 |
T |
 |
| Q |
218 |
agttcatatttt |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32915355 |
agttcatatttt |
32915366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University