View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_224 (Length: 243)
Name: NF8905A_low_224
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_224 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 32124998 - 32124760
Alignment:
| Q |
1 |
aatatgttcttcatttagagcgggaataagggaataaatgcgtgtgacaatgtgtttagctgcaagaggaaaagagaacttcaccacgtaaaataaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32124998 |
aatatgttcttcatttagagcgggaataagggaataaatgcgtgtgacaatgtgtttagctgcaagaggaaaagagaacttcaccacgtaaaataaaaag |
32124899 |
T |
|
| Q |
101 |
atgaatgttaaaaacaagtaaaattgactacaacaggtaaaattggaattccaggtttaacccttttttaaaagtgtgcatattatagagagaccctcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32124898 |
atgaatgttaaaaacaagtaaaattgactacaacaggtaaaattggaattccaggtttaatccttttttaaaagtgtgcatattatagagagaccctcga |
32124799 |
T |
|
| Q |
201 |
taatttccctcacttatattgaatttttagtatttattg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32124798 |
taatttccctcacttatattgaatttttagcatttattg |
32124760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 161 - 238
Target Start/End: Complemental strand, 32150184 - 32150109
Alignment:
| Q |
161 |
cccttttttaaaagtgtgcatattatagagagaccctcgataatttccctcacttatattgaatttttagtatttatt |
238 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||||| ||||||||| ||||||||| |||||||||| ||||||| |
|
|
| T |
32150184 |
cccttttataaaagtgtgcctatta--gagagaccctacataatttccttcacttatagtgaatttttaacatttatt |
32150109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University