View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_235 (Length: 240)
Name: NF8905A_low_235
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_235 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 9867855 - 9868088
Alignment:
| Q |
1 |
tttagtatcgatcttagtggtagttggatcactctgtctagaaaagttttattcacgtggaatttagtcatgcatggctaaacaaatatgactcaatcat |
100 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9867855 |
tttagtagcgatcgtagtggtaattggatcacaccatctagaaaagttttattaacgtggaatttagtcatgcatggctaaacaaatatgattcaatcat |
9867954 |
T |
 |
| Q |
101 |
catattcacgatgcatgacgaaatcatgatcaaagagagactggcgtcgcttctttatatttcaccaatgttccaaagcaatttttgtatgttgaattaa |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9867955 |
catattcacgatgcatggcgaaatcatgatcaaagagagactggcgtcgcttccttatatttcaccaatgttccaaagcaatttttgtatgttgaattaa |
9868054 |
T |
 |
| Q |
201 |
ggatagggtttgatgtgtgtggtatattattcga |
234 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||| |
|
|
| T |
9868055 |
ggaaagggtttgatgtgtgtggtatattgttcga |
9868088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University