View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_236 (Length: 240)
Name: NF8905A_low_236
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_236 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0007 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 2 - 240
Target Start/End: Complemental strand, 149919 - 149681
Alignment:
| Q |
2 |
ttggatttagaatttttgtgatttgaggtggtttttgttgttgtgctggtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaa |
101 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149919 |
ttggatttagaatgtttgtgatttgaggttgtttttgttgttgtgttggtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaa |
149820 |
T |
|
| Q |
102 |
ggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccccttgaaacatataatggagttgaaataaaagggtttgttccacttccacttaca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149819 |
ggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccacttgaaacatataatggagttgaaataaaagggtttgttccacttccacttaca |
149720 |
T |
|
| Q |
202 |
acaatttgtcgtgatgatgatgattgttgatgttggtga |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
149719 |
acaatttgttgtgatgatgatgattgttgatgttggtga |
149681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University