View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_246 (Length: 236)
Name: NF8905A_low_246
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_246 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 211
Target Start/End: Original strand, 33339235 - 33339433
Alignment:
| Q |
13 |
gaagcaaagataaagtaggggaggcattgtggctagctaaccaaatgagaaatttatatttttccggaacttgcaatctccaaatccaagtccatgaatg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
33339235 |
gaagcaaagataaagtaggggaggcattgtggcaagctaaccaaatgagaaatttatatttttccagaacttacaatctccaaatccaaatccatgaatg |
33339334 |
T |
|
| Q |
113 |
atgagaactaggatcagccactgtagctttgagggaaagaagccatgcataacggcttttagtagtgtagctgccatttttgttgtgagcccaaattat |
211 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33339335 |
atgagaactaggatctgccactgtagctttgagggaaagaagccatgcatagccgcttttagtagtgtagctgccatttttgttgtgagcccaaattat |
33339433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 117
Target Start/End: Original strand, 55417246 - 55417300
Alignment:
| Q |
63 |
aatttatatttttccggaacttgcaatctccaaatccaagtccatgaatgatgag |
117 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| ||| || ||||||| |
|
|
| T |
55417246 |
aatttatatttttccggaaggtgcaatgtccaaatccaagaccaagactgatgag |
55417300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 102
Target Start/End: Original strand, 10116127 - 10116216
Alignment:
| Q |
13 |
gaagcaaagataaagtaggggaggcattgtggctagctaaccaaatgagaaatttatatttttccggaacttgcaatctccaaatccaag |
102 |
Q |
| |
|
||||||||||||| ||||| || |||||||| | || ||||| | ||||||||||||||||||| |||| ||||| ||||| ||||||| |
|
|
| T |
10116127 |
gaagcaaagataaggtaggagaagcattgtgacaagtaaaccatacgagaaatttatatttttccagaacctgcaacctccatatccaag |
10116216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University