View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_250 (Length: 235)
Name: NF8905A_low_250
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_250 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 200
Target Start/End: Original strand, 2827297 - 2827486
Alignment:
| Q |
11 |
acatcattatattccctatgcttcttcaatttgacccgggttgactgtgatactgcactccttttgttactaaaaccatcattgtcattgagatcctctt |
110 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2827297 |
acatcattatataccttatgcttcttcaatttgacccgggttgactgtgatgctgcactccttttgttactaaaatcatcattgtcattgagatcctctt |
2827396 |
T |
 |
| Q |
111 |
cctctccaaaagtgctcctaaatgcttgaagtggagtcggcatcgctgtcctccttggccttgccccagtagttgaagaatcatgaggtc |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2827397 |
cctctccaaaagggctcctaaatgcttgaagtggagtcggcatcgctgtcctccttggctttgccccagtagttgaagaatcatgaggtc |
2827486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University