View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_253 (Length: 234)
Name: NF8905A_low_253
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_253 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 23 - 207
Target Start/End: Original strand, 6073565 - 6073749
Alignment:
| Q |
23 |
ggagttcatttgcggaggagtcacggaggcgacagaggtaaacggtgcctatgtcgccggcgcctatacggcggaggagatggacatcacggaaggtgag |
122 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6073565 |
ggagttcatttgaggaggagtcacggaggcgacagaggtaaacggtgcctatgtcgccggcgcctatacggcggaggagatggaagtcacggaaggtgag |
6073664 |
T |
|
| Q |
123 |
gccggatttgcggatggcggtgtaggcaaagtcggacgaacnnnnnnnnttgatggagagtgattccggcgaggagggtggaagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
6073665 |
gccggatttgcggatggcggtgtaggcgaagtcggaggaacgatgaggtttgatggagagagattccggcgaggaggatggaagt |
6073749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University