View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_271 (Length: 229)
Name: NF8905A_low_271
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_271 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 46 - 229
Target Start/End: Original strand, 10313562 - 10313745
Alignment:
| Q |
46 |
cccaattcagtgcccatagcaaacccgaagctattgtgatatgtacttcacaacttggtgcaaaccattcagtgttggccaaaacaaaaacacctcagtc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10313562 |
cccaattcagtgcccatagcaaacccgaagctactgtgatatgtacttcacaacttggtgaaaaccattcagtgttggccaaaacaaaaacacctcagtc |
10313661 |
T |
 |
| Q |
146 |
atctcggctatacacacccaacttaatgtggaatactcaaaggagttgaaacggcgcatggcaatatacagacattggatgtga |
229 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||| | |||||||| ||||||||||||| |
|
|
| T |
10313662 |
atctcggctatacacacctagcttaatgtggaatactcaaaggagttgaaatggcgcattgtaatatacacacattggatgtga |
10313745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 10313489 - 10313532
Alignment:
| Q |
1 |
gcaatgaattccacaacatcactctatgaagaggctgtgctatc |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10313489 |
gcaatgaattccacaacatcactctatgaagaggctgtgctatc |
10313532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University