View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_276 (Length: 229)
Name: NF8905A_low_276
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_276 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 37 - 182
Target Start/End: Complemental strand, 44151867 - 44151724
Alignment:
| Q |
37 |
tttggatcaagctggatatgacaaaagtacgatagtttgatgttcaagtgaaacattaccgcggcaacaaattggcacgtccgatgggagattagtttga |
136 |
Q |
| |
|
|||||||||||| ||| |||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44151867 |
tttggatcaagcaggacatgacaaa-gcacgttagtttgatgttcaagtgaaacattaccgcggcaacaaattggcacgtccgatgggagattagtttga |
44151769 |
T |
|
| Q |
137 |
gatagccgttgtcaagtttccagtaaccagaaaccgttaatcgtac |
182 |
Q |
| |
|
| ||| | |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
44151768 |
g-tagtcattgtcaagattctagtaaccagaaaccgttaatcgtac |
44151724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 40
Target Start/End: Complemental strand, 44151950 - 44151917
Alignment:
| Q |
7 |
ctactcattacaaacaatgctcttattgtctttg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44151950 |
ctactcattacaaacaatgctcttattgtctttg |
44151917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University