View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_286 (Length: 226)
Name: NF8905A_low_286
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_286 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 1531258 - 1531483
Alignment:
| Q |
1 |
ggtctcaaaaggtttaaacttatcactggcattatatttatgctcttctatgcactcatcctttttgttgctggggagacaacaaatttctttggtgaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1531258 |
ggtctcaaaaggtttaaacttatcactggcattatatttatgctcttctatgcactcatcctttttgttgctggggagacaacaaatttctttggtgaca |
1531357 |
T |
|
| Q |
101 |
aagtggagaaatatccctttgctatgagttctgtgttagttcttatagttatcaagtgtctcatattagtaatttcagtcgtattagaagacccacctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1531358 |
aagtggagaaatatccctttgctatgagttctgtgttagttcttatagttatcaagtgtctcatattagtaatttcagtcgtattagaagacccacctct |
1531457 |
T |
|
| Q |
201 |
ttgtcttgtgcaaactatggttttga |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1531458 |
ttgtcttgtgcaaactatggttttga |
1531483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University