View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8905A_low_308 (Length: 216)

Name: NF8905A_low_308
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8905A_low_308
NF8905A_low_308
[»] chr8 (2 HSPs)
chr8 (20-88)||(127739-127807)
chr8 (170-216)||(127889-127935)
[»] chr3 (1 HSPs)
chr3 (20-88)||(33060096-33060164)


Alignment Details
Target: chr8 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 127739 - 127807
Alignment:
20 gatttgagaatgtgttaaatcctatcccagtatgctctggttgcgaggttttaggactcatccctggtc 88  Q
    ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||    
127739 gatttgagaatgtgttaaatcatatcccagtatgctctggttgcaaggttttaggactcatccctggtc 127807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 127889 - 127935
Alignment:
170 gaatggtacttaatataaaattttgtttctatgaacttacaggtttt 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
127889 gaatggtacttaatataaaattttgtttctatgaacttacaggtttt 127935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 33060096 - 33060164
Alignment:
20 gatttgagaatgtgttaaatcctatcccagtatgctctggttgcgaggttttaggactcatccctggtc 88  Q
    ||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||    
33060096 gatttgagaatgtgttaaatcctatcctagtctgctctggttgcaaggttttaggactcatccctggtc 33060164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University