View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_308 (Length: 216)
Name: NF8905A_low_308
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_308 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 127739 - 127807
Alignment:
| Q |
20 |
gatttgagaatgtgttaaatcctatcccagtatgctctggttgcgaggttttaggactcatccctggtc |
88 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
127739 |
gatttgagaatgtgttaaatcatatcccagtatgctctggttgcaaggttttaggactcatccctggtc |
127807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 127889 - 127935
Alignment:
| Q |
170 |
gaatggtacttaatataaaattttgtttctatgaacttacaggtttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
127889 |
gaatggtacttaatataaaattttgtttctatgaacttacaggtttt |
127935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 33060096 - 33060164
Alignment:
| Q |
20 |
gatttgagaatgtgttaaatcctatcccagtatgctctggttgcgaggttttaggactcatccctggtc |
88 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33060096 |
gatttgagaatgtgttaaatcctatcctagtctgctctggttgcaaggttttaggactcatccctggtc |
33060164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University