View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_320 (Length: 210)
Name: NF8905A_low_320
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_320 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 29 - 189
Target Start/End: Original strand, 29002182 - 29002342
Alignment:
| Q |
29 |
agaagccatatctaaagaaaagtgacacttggactgcaaggattgtgaaagcagaaccatttcgtaacaatggtggttgtggttttggtagtggtgatga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002182 |
agaagccatatctaaagaaaagtgacacttggactgcaaggattgtgaaagccgaaccatttcgtaacaatggtggttgtggttttggtagtggtgatga |
29002281 |
T |
|
| Q |
129 |
tgatcctgttgcttgggctcaaagggagttgaaaaagtctgaaactttcaatgatagagct |
189 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002282 |
tgatcctgttgcttgggctgaaagggagttgaaaaagtctgaaactttcaatgatagagct |
29002342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 29 - 189
Target Start/End: Original strand, 28962459 - 28962613
Alignment:
| Q |
29 |
agaagccatatctaaagaaaagtgacacttggactgcaaggattgtgaaagcagaaccatttcgtaacaatggtggttgtggttttggtagtggtgatga |
128 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| || || |||||||||| |
|
|
| T |
28962459 |
agaagccacatctgaagaaaagtggcacttggactgcaaggattgtgaaagcagaaccatttcgtaacaatggcggtt------tttgtggtggtgatga |
28962552 |
T |
|
| Q |
129 |
tgatcctgttgcttgggctcaaagggagttgaaaaagtctgaaactttcaatgatagagct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28962553 |
tgatcctgttgcttgggctcaaagggagttgaaaaagtctgaaacattcaatgatagagct |
28962613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University