View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_326 (Length: 208)
Name: NF8905A_low_326
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_326 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 47094268 - 47094433
Alignment:
| Q |
22 |
gagagggtttggttttgttgttgagtttggttgagttggagaatgtagtagttgtgagtagtaagaagatgatgaacgtgtttgagtggtttgttttggg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47094268 |
gagagggtttggttttgttgttgagtttggttgagttggagaatgtagtagttgtgagtagtaagaagatgatgaaagtgtttgagtggtttgttttggg |
47094367 |
T |
 |
| Q |
122 |
tgccattgttgaatagaggtgagatgagtgatgagaatgtttgttgttcatttgaaatagttgtta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47094368 |
tgccattgttgaatagaggtgagatgagtgatgagaatgttttttgttcatttgaaatagttgtta |
47094433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University