View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_327 (Length: 208)
Name: NF8905A_low_327
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_327 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 18164215 - 18164418
Alignment:
| Q |
1 |
tgcatgcattatgatctgcatctagtataagcatgaaaagaaatgttcaaaattattgcatagtaaaaggagattagcaacatctccaatgggattttat |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18164215 |
tgcattcattatgatctgcatctagtataagcatgaaaagaaattttcaaaattattgcatagtaaaaggagattagcaacatctccaatgagattttat |
18164314 |
T |
|
| Q |
101 |
gtaatctgtgtgtatctgaatactataaattctagttttatatctaaactattaactcaaagtttcattgtcgccggaaagaaaaaacagatgatgtcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18164315 |
gtaatctgtgtgtatctgaatactataaattctagttttatatctaaactattaactcaaagtttcattgtcgccggaaagaaaaaacagatgatcacca |
18164414 |
T |
|
| Q |
201 |
tctc |
204 |
Q |
| |
|
|||| |
|
|
| T |
18164415 |
tctc |
18164418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University