View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_338 (Length: 202)
Name: NF8905A_low_338
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_338 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 16 - 133
Target Start/End: Original strand, 15909009 - 15909126
Alignment:
| Q |
16 |
tggtgtttgagactgacatgacatcgacatatgttgctacattcaattgtcgaagtgtcaatgtctagttaagtgtctgtgcttcataatttatggtcgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
15909009 |
tggtgtttgagactgacatgacatcgacatatgttgctacattcaattgtcgaagtgtcaatgtctagttcagtgtctgtgcttcatagtttatgatcgt |
15909108 |
T |
|
| Q |
116 |
tagaaacaagcttataag |
133 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
15909109 |
tagaaacaagcttgtaag |
15909126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University