View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_62 (Length: 344)
Name: NF8905A_low_62
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_62 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 34314392 - 34314723
Alignment:
| Q |
1 |
aaagaggagtattatatcaagtgaacaatttgtttgtgagagttcacgatggttgatattgtaaatatgtttgagaatcagttaatttgtgatcattctg |
100 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
34314392 |
aaagaggagtgttatatcaagcgaacaatttgtttgtgagagttcacgatggttgatattataaatatgtttcggaatcagctaatttgtgatcattctg |
34314491 |
T |
|
| Q |
101 |
tctgaatctctattgtaacttttctgctattttctcttacatactttatgttaaggaaatagtctctttgtttttaatatattccgttttgatttcttnn |
200 |
Q |
| |
|
| ||||||||||| |||||||||| |||| |||||||||||| |||||| ||||| ||||| ||||| ||| |||||||||| | |||||||||| | |
|
|
| T |
34314492 |
tatgaatctctatcgtaacttttcgactatcttctcttacatattttatgctaagggaatagactcttagttcttaatatatttcattttgatttcgt-- |
34314589 |
T |
|
| Q |
201 |
nnnnnnnnntagaaattaata--atatatactactctcttgtatcaagttgtcattattattcaagactttgtattttattggaattgcagtctcattct |
298 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34314590 |
aaaaaaaaataggaattaataatatatatactactctcttgtatcaagttgtcattattattcaagactttgtattttattggaattgcagtctcattct |
34314689 |
T |
|
| Q |
299 |
ttatcttctttattcttctctataagtctatatt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34314690 |
ttatcttctttattcttctctataagtctatatt |
34314723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University