View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_80 (Length: 316)
Name: NF8905A_low_80
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 6 - 106
Target Start/End: Original strand, 9303418 - 9303518
Alignment:
| Q |
6 |
tttggtgttattgctttgtgtggttggttgactggttttggtgatgttgttcgtgatggtgatttttgatgttatgtggtcttggttttgatttggttac |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9303418 |
tttgatgttattgctttgtgtggttggttgactggttttggtggtgatgttcgtgatggtgatttttgatgttatgtggtcttggttttgatttggttac |
9303517 |
T |
 |
| Q |
106 |
g |
106 |
Q |
| |
|
| |
|
|
| T |
9303518 |
g |
9303518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 219 - 311
Target Start/End: Original strand, 9303619 - 9303712
Alignment:
| Q |
219 |
attactggtttatgatggtatcagacaaggtttggaattagg-ttgatgcaaaatttggcagctttccttgtgttttttcttgatgtccatctc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9303619 |
attactggtttatgatggtatcagacaaggtttggaattagggttgatgcaaaatttggcagctttccttgtgttttttcttgatgtccttctc |
9303712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University