View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8905A_low_98 (Length: 295)
Name: NF8905A_low_98
Description: NF8905A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8905A_low_98 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 6 - 295
Target Start/End: Complemental strand, 16294641 - 16294352
Alignment:
| Q |
6 |
gtttggtgttgatgttattgagactcaattcaacttcttcaaactttgcaatttcattcatttgagcttttatcatagacatagctattggtttacacaa |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16294641 |
gtttggtggtgatgttattgagactcaattcaacttcttcaaactttgcaatttcattcatttgagcttttatcatagacatagctattggtgtacacaa |
16294542 |
T |
 |
| Q |
106 |
caattttgttactatcactaaaagaggatatctgaaagtagctcaaacagctacctttcaagagacataaaaaccattaatgagtggtttccatgttggt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16294541 |
caattttgttactatcactaaaagaggatatctgaaagtagctcaaacagctacctttcaagagacataaaaaccattaatgagtggtttccatgttggt |
16294442 |
T |
 |
| Q |
206 |
ggtaataacgttgtttattttacttttctcataaatatatggttcatgttgctgggctgtcatacacattacaacctcgtctttccttga |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16294441 |
ggtaataacgttgtttattttacttttctcataaatataaggttcatgttgctgggctgtcatacacattacaacctcgtctttccttga |
16294352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University