View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8906_high_4 (Length: 454)
Name: NF8906_high_4
Description: NF8906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8906_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 6e-75; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 16 - 162
Target Start/End: Complemental strand, 27771232 - 27771086
Alignment:
| Q |
16 |
catcaaagatatcacaaggagaaagtagtaaatcaaggtacaaaagaagagtgttgcattgtgttatgagtccaattgcaatgaagagatcgttttctaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27771232 |
catcaaagatatcacaaggagaaagtagtaaatcaaggtacaaaagaagagtgttgcattgtgttatgagtccaattgcaatgaagagatcgttttctaa |
27771133 |
T |
|
| Q |
116 |
tggaagattttcactaggtaaaattgatagaggaaaaaggcaaggaa |
162 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27771132 |
tggaagattttcacttggtaaaattgatagaggaaaaaggcaaggaa |
27771086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 330 - 438
Target Start/End: Complemental strand, 27770908 - 27770800
Alignment:
| Q |
330 |
aaatatgtatatgttatttatgcaatttggatccctgaattaatgggatcaagattctttgcaggaaggatatcttgaattcatttattcaagatatagt |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27770908 |
aaatatgtatatgttatttatgcaatttggatccctgaattaatgggatcaagattctttgcaggaaggatatcttgaattcatttattcaagatatagt |
27770809 |
T |
|
| Q |
430 |
tgatagttg |
438 |
Q |
| |
|
||||||||| |
|
|
| T |
27770808 |
tgatagttg |
27770800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 211 - 262
Target Start/End: Complemental strand, 27771038 - 27770987
Alignment:
| Q |
211 |
atgatatattaagaagagagatagaccaattttttgtgtgaagattgcataa |
262 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27771038 |
atgatatattaagaagagagacagaccaattttttgtgtgaagattgcataa |
27770987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 69 - 126
Target Start/End: Complemental strand, 12617343 - 12617286
Alignment:
| Q |
69 |
ttgcattgtgttatgagtccaattgcaatgaagagatcgttttctaatggaagatttt |
126 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
12617343 |
ttgcattgtgtgctaagtccaattgcaatgaagagatcattttcaagtggaagatttt |
12617286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University