View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8906_low_33 (Length: 341)
Name: NF8906_low_33
Description: NF8906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8906_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 325
Target Start/End: Complemental strand, 43607834 - 43607509
Alignment:
| Q |
1 |
ttcccaacaccaactctccttacatgttaagttattatataagcctatgaattgggttttatttatccagcacgccctcttctacaa-ggtccctttggg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
43607834 |
ttcccaacaccaactctccttacatgttaagttattatataagcctatgaattgggttttatttatccagcacgccctcttctaaaaaggtccctttggg |
43607735 |
T |
 |
| Q |
100 |
cggcttcaagcatagacaatgcaaactttgctaatgccgatttatgatattcttaggcttaagtacttaatttcattccaaagatggggttgacattggt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43607734 |
cggcttcaagcatagacaatgcaaactttgctaatgctgatttatgatattcttaggcttaagtacttaatttcattccaaagatggggttgacaatggt |
43607635 |
T |
 |
| Q |
200 |
taaactcccaaccacttggtcgaagaggcgccaataataatgtcaaagagaaattctcataaatgctatatctactaggtagaaacccaagactgatttg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607634 |
taaactcccaaccacttggtcgaagaggcgccaataataatgtcaaagagaaattctcataaatgctatatctactaggtagaaacccaagactgatttg |
43607535 |
T |
 |
| Q |
300 |
tgtattgctgagtctcagagttcata |
325 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43607534 |
tgtattgctgagtctcagagttcata |
43607509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University