View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8906_low_36 (Length: 324)
Name: NF8906_low_36
Description: NF8906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8906_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 162 - 312
Target Start/End: Original strand, 45665277 - 45665431
Alignment:
| Q |
162 |
gactgatcacggccttgtctcgtgtgtattcagtacgtaaataagaaagatcactttcagatttggttg-nnnnnnnngttggttacgaaac---nnnnn |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45665277 |
gactgatcacggccttgtctcgtgtgtattcagtacgtaaataagaaagatcactttcagatttggttgtttttttttgttggttacgaaacaaaaaaaa |
45665376 |
T |
 |
| Q |
258 |
nnntgcacagaaaccaaacactcttcaataataacatcatatagctgctcatctc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45665377 |
aaatgcacagaaaccaaacactcttcaataataacatcatatagctgctcatctc |
45665431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 27 - 102
Target Start/End: Original strand, 45665142 - 45665217
Alignment:
| Q |
27 |
ataaattaaaaataaaagcaaacacgaaatgaggtataaaaaaggaagatcaatttatggacaatttagaacgatg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45665142 |
ataaattaaaaataaaagcaaacacgaaatgaggtgtaaaaaaggaagatcaatttatggacaatttagaacgatg |
45665217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University