View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8906_low_45 (Length: 282)
Name: NF8906_low_45
Description: NF8906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8906_low_45 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 33119673 - 33119939
Alignment:
| Q |
18 |
actctaaagctattgaccctgctaaatgggattgtatgacttgtcttaaagatgaatcaaattgtggcttctgtgcttccaccgatagggtaaacaaagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33119673 |
actctaaagctattgaccctgctaaatgggattgtatgacttgtcttaaagatgaatcaaattgtggcttctgtgattccaccgataaggtaaacaaagt |
33119772 |
T |
 |
| Q |
118 |
agtttaaatttattatgctct--tatatattcattgttgttaagagcttttatacataatcttgtatcgaatgttggttttgcagctaaaaccaggggca |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
33119773 |
agtttaaatttattatgctcttgtatatattcatcgttgttaagagctcttatacataatcttgtatcaaatgttgggtttgcagctaaaaccgggggca |
33119872 |
T |
 |
| Q |
216 |
tgcttaatccaagatgacgcgtctaaggagcgttgcgaatcacagcatagggattggtacacacaag |
282 |
Q |
| |
|
| |||||||||||| ||||| ||||||||||| |||| |||||| || || |||||||||||||||| |
|
|
| T |
33119873 |
tacttaatccaagacgacgcatctaaggagcgctgcgcatcacaacacagagattggtacacacaag |
33119939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University