View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8906_low_48 (Length: 255)
Name: NF8906_low_48
Description: NF8906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8906_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 2054844 - 2055099
Alignment:
| Q |
1 |
ttacttttttagttgcaaaatatttaagtgaagtatgtggtatatatcnnnnnnnaagcaatatttataacatgttttacttacttgttgtacttaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2054844 |
ttacttttttagttgcaaaatatttaagtgaagtatgtggtatatatctttttttaagcaatatttataacatgttttacttacttgttgtacttaaaag |
2054943 |
T |
 |
| Q |
101 |
aataataaaaaattaaaggtataacag-aaaagtgatattgatg--------------taaaacgacttataatcaaagataattttcacctatatcatt |
185 |
Q |
| |
|
||||||||| ||||||||||||||||| |||| | ||||||||| |||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
2054944 |
aataataaacaattaaaggtataacagaaaaaattatattgatgttatattgttattataaaacgacttataatcaaagataattttctcctatagcatt |
2055043 |
T |
 |
| Q |
186 |
ttataatttaggacaggtcgagtcgattattatttttacaaacacggtagtattat |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2055044 |
ttataatttaggacagatcgagtcgattattatttttacaaacacggtagtattat |
2055099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University