View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8906_low_52 (Length: 250)
Name: NF8906_low_52
Description: NF8906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8906_low_52 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 37514906 - 37514657
Alignment:
| Q |
1 |
tatgaacccggttttcaccaggtaataaataattactttgatttaacggattttgttggtgatttctttataaaatggtgatttaggaacaatgttctcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37514906 |
tatgaacccggttttcaccaggtaataaataattactttgatttaacgaattttgttggtgatttctttataaaatggtgatttaggaacaatgttctcg |
37514807 |
T |
|
| Q |
101 |
ggactaaattggtgatatcataactaattagtctccaaaatttaggattccggattccctgaccgcagagaatccgcgtcctgattttagaggctaaatt |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37514806 |
ggactaaattggtgatatcagaactaattagtctccaaaatttaggattccggattccctgaccgcagggaatccgcgtcctgattttagaggctaaatt |
37514707 |
T |
|
| Q |
201 |
ggttattgattcgctcattttattgttcttcttccaaatttatcctctat |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37514706 |
ggttattgattcgctcattttattattcttcttccaaatttatcctctat |
37514657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University