View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8906_low_59 (Length: 237)

Name: NF8906_low_59
Description: NF8906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8906_low_59
NF8906_low_59
[»] chr5 (1 HSPs)
chr5 (9-224)||(9967152-9967368)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 9967368 - 9967152
Alignment:
9 agatggacatcaagtagtaaacgaacatattgaaatctttctttaccctcgtgcgccttcagctgcatatacctttggaaagccgtcaaacatgccctta 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9967368 agatggacatcaagtagtaaacgaacatattgaaatctttctttaccctcgtgcgccttcagctgcatatacctttggaaagccgtcaaacatgccctta 9967269  T
109 gcataactaggttgtgcttgaaccctgactttaacagcttcaaatggacatagagctaaattggcaaatacttcagcagatgcactactaa-gaaaatat 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
9967268 gcataactaggttgtgcttgaaccctgactttaacagcttcaaatggacatagagctaaattggcaaatacttcagcagatgcactactaaggaaaatat 9967169  T
208 acaagacttctgtgctg 224  Q
    |||||||||||||||||    
9967168 acaagacttctgtgctg 9967152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University