View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8906_low_64 (Length: 223)
Name: NF8906_low_64
Description: NF8906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8906_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 39096136 - 39096328
Alignment:
| Q |
19 |
catgtatcaggaaggatgaaatgaaactcttcccccaaccgccaccaacaacatcgccccaactttcgattacatgatgtcgatgacgaagaatgccgca |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||| || |||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
39096136 |
catgtatcaggaaggatgaaaggaaactcttcccctaaccgccaccaacaacagcgtcccaactttcgattacatgatgccgatgatgaagaatgccgca |
39096235 |
T |
|
| Q |
119 |
acgacattggttttgccttcccggtagttctctatttcatataattaatttctccccttcttatttgttgatagaatcatattgaaacaccaa |
211 |
Q |
| |
|
||| ||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39096236 |
acggcattggttttgccttaccggcagttctctatttcatataatcaatttctccccttcttatttgttgatagaatcatattgaaacaccaa |
39096328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 57
Target Start/End: Original strand, 23176578 - 23176616
Alignment:
| Q |
19 |
catgtatcaggaaggatgaaatgaaactcttcccccaac |
57 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
23176578 |
catgtatcaggaaggatgagaggaaactcttcccccaac |
23176616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 95
Target Start/End: Original strand, 23176612 - 23176644
Alignment:
| Q |
63 |
ccaacaacatcgccccaactttcgattacatga |
95 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
23176612 |
ccaacaacagcgccccaactttcgattacatga |
23176644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 6012466 - 6012428
Alignment:
| Q |
166 |
atttctccccttcttatttgttgatagaatcatattgaa |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
6012466 |
atttctccccatcttatttgttgatagaatcacattgaa |
6012428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University