View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8907_low_33 (Length: 241)
Name: NF8907_low_33
Description: NF8907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8907_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 10588607 - 10588394
Alignment:
| Q |
10 |
agcagagaggagcttgaatatctagtgggaaagaagagtctaaacttgagtgagttcttgtgcttttatgactccatattgaatcacaaaaatggtgatg |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10588607 |
agcatagaggagcttgaatatctagtgggaaagaagagtctaaacttgagtgagttcttgtgcttttatgactccatattgaatcacaaaaatggtgatg |
10588508 |
T |
 |
| Q |
110 |
gtggtgatgctgagattgaagagttagaaagtgatcttttgaagactttcaaggtgtttgatatagatggagatggattcatcactagtcaagagctgga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10588507 |
gtggtgatgctgagattgaagagttagaaagtgatcttttgaagactttcaaggtgtttgatttagatggagatggattcatcactagtcaagagctgga |
10588408 |
T |
 |
| Q |
210 |
atgtgtgttgaaga |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10588407 |
atgtgtgttgaaga |
10588394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 120 - 223
Target Start/End: Original strand, 40394480 - 40394583
Alignment:
| Q |
120 |
tgagattgaagagttagaaagtgatcttttgaagactttcaaggtgtttgatatagatggagatggattcatcactagtcaagagctggaatgtgtgttg |
219 |
Q |
| |
|
||||| ||| ||||| || || |||||| ||||||||||||| ||||||||| | ||||||||||||||||| || || |||||||| || ||||||||| |
|
|
| T |
40394480 |
tgagaatgatgagttggagagggatcttgtgaagactttcaaagtgtttgatttggatggagatggattcattacaagccaagagcttgagtgtgtgttg |
40394579 |
T |
 |
| Q |
220 |
aaga |
223 |
Q |
| |
|
|||| |
|
|
| T |
40394580 |
aaga |
40394583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University