View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8907_low_34 (Length: 241)
Name: NF8907_low_34
Description: NF8907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8907_low_34 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 15484838 - 15485067
Alignment:
| Q |
11 |
acatcatcgtacaaaaatatgttatgtaataaaacataacactctctcacactttccacactaacttatataactctttgtgcattttagacttacattt |
110 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
15484838 |
acatcatcctgcaaaacaatgttatgtaataaaacataacactctctcacactttccacactaacttacattactctttgtgcattttagacttacattt |
15484937 |
T |
 |
| Q |
111 |
actatcaaagttcatattgttccttatgatgcatatttacacacctactaaaatcttcaactttgtctatgtaccaaattgggtttctcacatagctaga |
210 |
Q |
| |
|
| |||||| |||||| ||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
15484938 |
attatcaatgttcat-ttgctccttatgatgcatatttacacacctactcaaagcttcaactttgtctatgtaccaaatcgggtttttcacatagctaga |
15485036 |
T |
 |
| Q |
211 |
tctcagagggactaaaagcctctactagttc |
241 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |
|
|
| T |
15485037 |
tctcagagggactaaaagtctctactagttc |
15485067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 122
Target Start/End: Original strand, 2875695 - 2875747
Alignment:
| Q |
70 |
actaacttatataactctttgtgcattttagacttacatttactatcaaagtt |
122 |
Q |
| |
|
|||||||||| | ||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2875695 |
actaacttatgttactatttatgcattttagacttacatttactatcaaagtt |
2875747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University