View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8907_low_37 (Length: 227)
Name: NF8907_low_37
Description: NF8907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8907_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 38357946 - 38357720
Alignment:
| Q |
1 |
ctctaattttaaccttttttcaacctaggtaccaaattaataatctattcattgnnnnnnnnnnttgtaagaacaacgtttaaagatgttaaaattgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357946 |
ctctaattttaaccttttttcaacctaggtaccaaattaataatctattaattgaaaacaaaaattgtaagaacaacgtttaaagatgttaaaattgtga |
38357847 |
T |
 |
| Q |
101 |
tttcatacctgtcttaacgatgagaagaatttcgaataggtggaagacattgataat-gtccacttttgttgtaacggtgcattggattagactatatag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38357846 |
tttcatacctgtcttaacgatgagaagaatttcgaataggaggaagacattgataatggtccacttttgttgtaacggtgcattggattagactatatag |
38357747 |
T |
 |
| Q |
200 |
aagtatttatgatatttatttgtttat |
226 |
Q |
| |
|
|||||||| |||||||||||||||||| |
|
|
| T |
38357746 |
aagtatttgtgatatttatttgtttat |
38357720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University