View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_high_24 (Length: 454)
Name: NF8908_high_24
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 301
Target Start/End: Complemental strand, 2625140 - 2624860
Alignment:
| Q |
19 |
caaattccaatgagtagtcatccaaacttaagtcaagctgctatccaatggtattgttgttaggatattgtcctttgctgacattctatggcaacaaaca |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625140 |
caaattccaacgagtagtcatccaaacttaagtcaagctgctatccaatggtattgttgttaggatattgtcctttgctgacattctatggcaacaaaca |
2625041 |
T |
|
| Q |
119 |
ttcccagttgctataatatttcacctcttttgcaaaataatgttaatatcagcgcaactgctccgaggggggttttctttcaatcaggaatggtttgaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625040 |
ttcccagttgctataatatttcacctctt--gcaaaataatgttaatatcagcgcaactgctccgaggggggttttctttcaatcaggaatggtttgaat |
2624943 |
T |
|
| Q |
219 |
gtcaacaacaatgcaagtccttcaataacattgagcacaaagaacaccagatgggggcctgcagttgaatgttcaacagtgag |
301 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2624942 |
gtcaataacaatgcaagtccttcaataacattgagcacaaagaacaccagatgggggcctgcaattgaatgttcaacagtgag |
2624860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 355 - 439
Target Start/End: Complemental strand, 2624859 - 2624775
Alignment:
| Q |
355 |
ctagtttataaatttttagcattgacaccttcaattgaaggcatgccaagtgtagggcacgtgtcaatgtccaacacctacacag |
439 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2624859 |
ctagtttataaatatttagcattgacaccttcaattgaaggcatgccaagtgtcgggcacgtgtcaatgtccaacacctacacag |
2624775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University