View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_high_37 (Length: 367)
Name: NF8908_high_37
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 286
Target Start/End: Complemental strand, 248466 - 248187
Alignment:
| Q |
7 |
ttaaaaatcacgtcaaatttaatgttaggctcaaatgcactttttgtccctttattttaacttaattgaaattttagtcaattcatttcaaaaaaccatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
248466 |
ttaaaaatcacgtcaaatttaatgttaggctcaaatgcactttttgtccctttattttaaattaatcgaaattttagtcaattcatttcaaaaa-ccatt |
248368 |
T |
 |
| Q |
107 |
atttcagtccccttattatacatttcttgggnnnnnnn-agtccccttttagttttagtgatttgtcaatcttgtgttggctttcttacttttcatgtca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
248367 |
atttcagtccccttattatacatttcttgggttttttttagtccccttttagttttagtgatttgtcaatcttgtgttggctttcttacttttcatgtca |
248268 |
T |
 |
| Q |
206 |
ttgatagtactttaaaaatgattcatatcaattttggtgatctaacctagtgattaacacgtcataacatattttgtcaac |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
248267 |
ttgatagtactttaaaaatgattcatatcaattttggtgatctaacctagtgagtaacacgtcataacatattttgtcaac |
248187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 39 - 82
Target Start/End: Complemental strand, 22068929 - 22068886
Alignment:
| Q |
39 |
aaatgcactttttgtccctttattttaacttaattgaaatttta |
82 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
22068929 |
aaatgcacttttgatccccttattttaacttaattgaaatttta |
22068886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University