View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_high_47 (Length: 314)
Name: NF8908_high_47
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_high_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 26 - 295
Target Start/End: Complemental strand, 43165042 - 43164773
Alignment:
| Q |
26 |
gaggaacttgtctgaatgtcagtcaagtgccttacgggtgtcacacgccaagtgtgttgggcacacctaatcagaggtgtctgtggcgtgctacagaggt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43165042 |
gaggaacttgtctgaatgtcagtcaagttccttacgggtgtcacacgccaagtgtgttgggcacacctaatcagaggtgtctgtggcgtgctacagaggt |
43164943 |
T |
|
| Q |
126 |
tcaggtttatacaataaggtgcacattggtattcttgtcgtgatatctttttgaaacaacttaagcaataaaattaatttaaaacttaagtccaacttgc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43164942 |
tcaggtttatacaataaggtgcacattggtattcttgccgtgatatctttttgaaacaacttaagcaataaaattagtttaaaacttaagtccaacttgt |
43164843 |
T |
|
| Q |
226 |
tgaacctagaacttagaaagctttgccactctatagaatttaaccatatgaagatagttgacttacagaa |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164842 |
tgaacctagaacttagaaagctttgccactctatagaatttaaccatatgaagatagttgacttacagaa |
43164773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 109 - 161
Target Start/End: Original strand, 43222821 - 43222873
Alignment:
| Q |
109 |
tggcgtgctacagaggttcaggtttatacaataaggtgcacattggtattctt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
43222821 |
tggcgtgctacagaggttcaggtttatactataaggttcacattggcattctt |
43222873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University