View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_high_60 (Length: 250)
Name: NF8908_high_60
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_high_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 39730830 - 39730645
Alignment:
| Q |
1 |
aggtcaattttataatgcaaattggtgaaacaaattttacataatgcacaagtttatttttattattagatgaa--taaatcttatcacaagatcgcgtt |
98 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
39730830 |
aggtcaattttataatgcatattggtgaaacaaattttacataatgcacaagtttatttttatcattagatgaaaataaatcttatcacaagatcgcgtt |
39730731 |
T |
 |
| Q |
99 |
aaatgacataacttactgattttatggtagcaatgaaacttatacatgatgcatactttatttacttgtaagcattatacaaaact |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39730730 |
aaatgacataacttactgattttatggtagcaatgaaacttatacatgatgcatactttatttacttgtaagcattatacaaaact |
39730645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 195 - 250
Target Start/End: Complemental strand, 39730289 - 39730234
Alignment:
| Q |
195 |
gcaactagttcatatacacatatacgtgtctatagcagagataactatttaaacac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39730289 |
gcaactagttcatatacacatatacgtgtctatagcagagataactatttaaacac |
39730234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University