View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_high_72 (Length: 237)
Name: NF8908_high_72
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_high_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 11894439 - 11894662
Alignment:
| Q |
2 |
tttgcatcaggtgagagagaggtgtcaaaaagaatggtcaatgttcaaagagcgtttggctaatgctgagaaggattatttcaagcagcaaattaaggga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11894439 |
tttgcatcaggtgagagagaggtgtcaaaaagaatggtcaatgttcaaagagcgtttggctaatgcagagaaggattatttcaagcagcaaattaaggga |
11894538 |
T |
 |
| Q |
102 |
tttgtatatccccctaattagagacttaggacattcattatgcaaattaatttttgaaatgtgttac--ctctgttggtttcattccttgatgggttaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||| |
|
|
| T |
11894539 |
tttgtatatccccctaattagagacttaggacattcattatgcaaattaatttttgaaatgtgttacatctatgttggtttcattccttaatgggttaaa |
11894638 |
T |
 |
| Q |
200 |
ttaagtttggtatagaaattttat |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11894639 |
ttaagtttggtatagaaattttat |
11894662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University