View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_low_118 (Length: 289)
Name: NF8908_low_118
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_low_118 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 289
Target Start/End: Original strand, 41142554 - 41142824
Alignment:
| Q |
19 |
taattggtgtatttttgtaataaaatagatgactaatttgttgcaagtttgctagaaatagcagatgatccgaatgtagctccaaaaatgatttatttat |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41142554 |
taattggtttatttttgtaataaaatagatgactaatttgttgcaagcttgctagaaatagcagacgatccgaatgtagctccaaaaatgatttatttat |
41142653 |
T |
|
| Q |
119 |
atattgaattttataatactaatacggcataaactagaagcacgcaaacaaacaaaaacaacagctactccatctttgtctttttccccaaaactggatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41142654 |
atattgaattttataatactaatacggcataaactagaagcacgcaaacaaacaaaaacaacagctactccatctttgtctttttccccaaaactggatt |
41142753 |
T |
|
| Q |
219 |
ctcatctagcaggccgtacgtcactaaccatgcgccaatggcacagttcaactatatacttttctaaccta |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41142754 |
ctcatctagcaggccgtacgtcactaaccatgcgccaatggcacagttcaactatatacttttctaaccta |
41142824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University