View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_low_122 (Length: 277)
Name: NF8908_low_122
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_low_122 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 260
Target Start/End: Original strand, 17106924 - 17107165
Alignment:
| Q |
19 |
acgtatgtgtgttcaatttcatttgcttttagaacctttctcataatgcatgtttctgtactcattggtacgtttttattatgttcaatctcatggtctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||| |
|
|
| T |
17106924 |
acgtatgtgtgttcaatttcatttgcttttagaacctttctcataatgcatgtttctgtactcattcgtacgtttttattatgttcaatttcatcatctt |
17107023 |
T |
|
| Q |
119 |
ctctaggaactagtcataacacttccttgttggttgaaaaagttgttagcagttcagttggtccagataatcttgcaggagtagaaactagtttccatca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107024 |
ctctaggaactagtcataacacttccttgttggttgaaaaagttgttagcagttcagttggtccagataatcttgcaggagtagaaactagtttccatca |
17107123 |
T |
|
| Q |
219 |
tattattaatggctctgcttcaacttcaaggttgtcattgat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107124 |
tattattaatggctctgcttcaacttcaaggttgtcattgat |
17107165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University