View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_low_126 (Length: 259)
Name: NF8908_low_126
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_low_126 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 259
Target Start/End: Complemental strand, 23906318 - 23906067
Alignment:
| Q |
8 |
tggacatcagaaatgaaggtttcactgttgttgattgtttctttcatcttcttactttacaatttcagtttctattttcttttgcaagtgtgtttctttg |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23906318 |
tggacatgagaaatgaaggtttcactgttgttgattgtttctttcttcttcttactttacaatttcagtttctattttcttttgcaagtgtgtttctttg |
23906219 |
T |
 |
| Q |
108 |
gcttcaactaaattttgttaggtttgttcannnnnnnnccctccaaatttgtatctttattggaaacaaagtnnnnnnnnttatattctcttgattgaat |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23906218 |
gcttcaactaaattttgttaggtttattcattttttttccctccaaatttgtatctttattggaaacaaagtaaaaaaaattatattctcttgattgaat |
23906119 |
T |
 |
| Q |
208 |
ggtcctctgtgatgtaagaataatggtcacaaggaagcgtttttggattgtc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23906118 |
ggtcctctgtgatgtaagaataatggtcacaaggaagggtttttggattgtc |
23906067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 41 - 88
Target Start/End: Complemental strand, 25524562 - 25524515
Alignment:
| Q |
41 |
attgtttctttcatcttcttactttacaatttcagtttctattttctt |
88 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||| |
|
|
| T |
25524562 |
attgtttcttttttctccttattttacaatttcagtttctattttctt |
25524515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University