View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_low_128 (Length: 255)
Name: NF8908_low_128
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_low_128 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 44909610 - 44909835
Alignment:
| Q |
19 |
ttctttttattcaaactcaactctaacctaaattccattatttccctcaaattttatttatcgcgtgcaagctcaagttagggttttctccttctcagtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44909610 |
ttctttttattcaaactcaactctaacctaaattccattatttccctcaaattttatttatcgtgtgcaagctcaagttagggttttctccttctcagtg |
44909709 |
T |
|
| Q |
119 |
aaacttccaagcaacaacgaaagaattaacctgagatgtcgaagagaaagttcggattcgaaggtttcggcataaaccgtcaatcaacctacagtttcga |
218 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44909710 |
aaatttccaagcaacaacgaaagtattaacctgagatgtcgaagagaaagttcggattcgaaggtttcggcataaaccgtcaatcaacctacagtttcga |
44909809 |
T |
|
| Q |
219 |
acgatctcaacctcctcaacgtctct |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44909810 |
acgatctcaacctcctcaacgtctct |
44909835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University