View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_low_135 (Length: 250)
Name: NF8908_low_135
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_low_135 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 21 - 245
Target Start/End: Complemental strand, 194345 - 194121
Alignment:
| Q |
21 |
tgagcaacatcagaaacccatagaatgaaaggattattaatcaaacatgagacaggtggattttgttgggagattatggtagggaggacttgtttcccaa |
120 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194345 |
tgagcaacatcagaaacccatggaatgaaaggattgttaatcaaacatgagacaggtggattttgttgggagattatggtagggaggacttgtttcccaa |
194246 |
T |
 |
| Q |
121 |
ccctctctagctgtggcaaatacacatccaagtcaagccgttttggttcattctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcc |
220 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194245 |
ccatctctagttgtggcaaatacacatccaagtcaagccgttttggttcatcctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcc |
194146 |
T |
 |
| Q |
221 |
tatcacaacttccttctctgcttct |
245 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
194145 |
tatcacaacttccttctcttcttct |
194121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University