View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8908_low_139 (Length: 250)

Name: NF8908_low_139
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8908_low_139
NF8908_low_139
[»] chr5 (1 HSPs)
chr5 (21-245)||(194121-194345)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 21 - 245
Target Start/End: Complemental strand, 194345 - 194121
Alignment:
21 tgagcaacatcagaaacccatagaatgaaaggattattaatcaaacatgagacaggtggattttgttgggagattatggtagggaggacttgtttcccaa 120  Q
    ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
194345 tgagcaacatcagaaacccatggaatgaaaggattgttaatcaaacatgagacaggtggattttgttgggagattatggtagggaggacttgtttcccaa 194246  T
121 ccctctctagctgtggcaaatacacatccaagtcaagccgttttggttcattctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcc 220  Q
    || ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
194245 ccatctctagttgtggcaaatacacatccaagtcaagccgttttggttcatcctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcc 194146  T
221 tatcacaacttccttctctgcttct 245  Q
    ||||||||||||||||||| |||||    
194145 tatcacaacttccttctcttcttct 194121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University