View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_low_44 (Length: 478)
Name: NF8908_low_44
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 3e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 217 - 421
Target Start/End: Complemental strand, 12151645 - 12151436
Alignment:
| Q |
217 |
atttaaatgtt-atttctatccgaaatgctatttat------aggcatttggtgatcaattttctgcagaattatctttgcataatatgtccatgtagtg |
309 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| | || ||||||||| |||| ||||| ||||||||||| || ||||| |
|
|
| T |
12151645 |
atttaaatgtttatttctatccgaaatgctatttatcttctgaggcatttagcaattaattttctgtcgaatattctttacataatatgtctatttagtg |
12151546 |
T |
|
| Q |
310 |
cgtatatcggttgatatgatattgcaaattgtattaattcatgcgtacattaatgaataggatatacgagaaatggcaactattactttgctgatatatt |
409 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||| | ||||||||| ||||| ||||| | || |||||||||||| ||||||||| |
|
|
| T |
12151545 |
cgtatatcggttgatatgatattacaaattgtatgaattcatgcgtatactaatgaataagatat--gagaagttgcgactattactttgttgatatatt |
12151448 |
T |
|
| Q |
410 |
atgcatatttga |
421 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12151447 |
atgcatatttga |
12151436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 430 - 462
Target Start/End: Original strand, 5452540 - 5452572
Alignment:
| Q |
430 |
aagtgatcttttcattatgttgctgcatgatgt |
462 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
5452540 |
aagtgatcttttcattatgttgctgcaggatgt |
5452572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 89; Significance: 1e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 366 - 462
Target Start/End: Original strand, 10714952 - 10715048
Alignment:
| Q |
366 |
ataggatatacgagaaatggcaactattactttgctgatatattatgcatatttgatcgcaatgaagtgatcttttcattatgttgctgcatgatgt |
462 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10714952 |
ataggatatacgagaaatggcaactattactttgttgatatattatgcatatttgatctcaatgaagtgatcttttcattatgttgctgcatgatgt |
10715048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University