View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8908_low_57 (Length: 440)
Name: NF8908_low_57
Description: NF8908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8908_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 51318546 - 51318791
Alignment:
| Q |
1 |
taactttaattctcactcttctcttctcctccgttcaggtccttcccggagctaggttgcgtacagtcactccttcccttgcactcggcggtttcatctg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51318546 |
taacgttaattctcactcttctcttctcctccgttcaggtccgtcgcggagctaggttgcgtacagtcactccttcccttgcactcggcggtttcatctg |
51318645 |
T |
|
| Q |
101 |
cgcgtctcacttcttgcctcggaatcgattcaacaagttcgagatctttgtctcagggtatgctttgcagtgccaaccctggtgtttgattcatttccac |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51318646 |
cgcggctcacttcttgcctcggaatcgattcaacaagttcgagatctttgtctcagggtatgctttgcagtgccaaccctggtgtttgattcatttccac |
51318745 |
T |
|
| Q |
201 |
agatactactttttatcaccttttctatctgtaagcatattgcaac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51318746 |
agatactactttttatcaccttttctatctgtaagcatattgcaac |
51318791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 298 - 425
Target Start/End: Original strand, 51318843 - 51318970
Alignment:
| Q |
298 |
ggtagtcttagctatatttctgcgattaggttaattaaatctacattgaagttatcacggagctgagtgttgtttattggtgattaatagggtaatcata |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51318843 |
ggtagtcttagctatatttctgcgattaggttaattaaatctacattgaagttatcacggagctgagtgttgtttattggtgattaatagggtaatcaaa |
51318942 |
T |
|
| Q |
398 |
atagggatcaatttttcatacaccgtct |
425 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51318943 |
atagggatcaatttttcatacaccgtct |
51318970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University