View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8909_high_14 (Length: 241)
Name: NF8909_high_14
Description: NF8909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8909_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 24580494 - 24580319
Alignment:
| Q |
46 |
tataaggaataaaagcatggttatatagggaatgcttccacttttatgctattgataaacatggtatgttttgaaaagcactacattaattcagaattga |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
24580494 |
tataaggaataaaagcatggttatatagggaatgcttccacttttatgctattgataaacatggtatgttttgaaaaacactacatt----cagaattga |
24580399 |
T |
 |
| Q |
146 |
gtcttcacatgtctttaattaaaaaaggagctttcaacgagaaagagatcaaagaagagcttttggaggaggaaagcgtg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24580398 |
gtcttcacatgtctttaattaaaaaaggagctttcaacgagaaagagatcaaagaagagcttttggaggaggaaagcgtg |
24580319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University