View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8909_high_15 (Length: 238)

Name: NF8909_high_15
Description: NF8909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8909_high_15
NF8909_high_15
[»] chr4 (1 HSPs)
chr4 (48-223)||(41668201-41668372)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 48 - 223
Target Start/End: Complemental strand, 41668372 - 41668201
Alignment:
48 ggattgcgttataaatgatacctcctagtctcnnnnnnngttcagggtcattatcataacnnnnnnnnnnaaaaataataatagttggggaggggaacnn 147  Q
    ||||||||||||||| ||||||||||||||||       ||||| |||||||||||||||          ||||||||||||  ||||||||||||||      
41668372 ggattgcgttataaacgatacctcctagtctctttttttgttcatggtcattatcataactttttttttaaaaaataataatgattggggaggggaactt 41668273  T
148 nnnnnattaattaaaatggtaacaaacaatgatcattttaccaccatccggaatttgaacattgtacattgaggtt 223  Q
         ||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||    
41668272 tttttattaattaaaatggtaacaa----tgatcattttaccaccatccggaatttgaacattgtacattgaggtt 41668201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University