View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8909_low_10 (Length: 519)
Name: NF8909_low_10
Description: NF8909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8909_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 447; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 447; E-Value: 0
Query Start/End: Original strand, 24 - 502
Target Start/End: Complemental strand, 34867298 - 34866820
Alignment:
| Q |
24 |
ggtagctgctgagaaagatatggcatggtttctctttgagattatcttctatctctttctttacgtggcttattacacaaaactccattaattttcattt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34867298 |
ggtagctgctgagaaagatatggcatggtttctctttgagattatcttctatctctttctttacgtggcttgttacacaaaactccattaattttcattt |
34867199 |
T |
|
| Q |
124 |
tgaattttatgggttaagatatggcatgtttatccacttctgtgataatatttttgaagccgtgaggactctttgcttgtagtatttttattgtgagtca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867198 |
tgaattttatgggttaagatatggcatggttatccacttctgtgatgatatttttgaagccgtgaggactctttgcttgtagtatttttattgtgagtca |
34867099 |
T |
|
| Q |
224 |
ttatagtcatcactcttcaaaattgttgcttaagtggcattgtgcatgctaaccagctgccatggaaatgccttatgtgtttcaagaagcttctggaggt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867098 |
ttatagtcatcactcttcaaaattgttgcttaagtggcattatgcatgctaaccggctgccatggaaatgccttatgtgtttcaagaagcttctggaggt |
34866999 |
T |
|
| Q |
324 |
caacgaaaaaacaaatctggtgtctagagttccttggaactagtttgtcagatttggtttgtcggataattgtggtggttcagcttttaatggattttaa |
423 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34866998 |
caacgaaaaaacagatctggtgtctagagttccttggaactagttagtcagatttggtttgtcggataattgtggtggttcagcttttaatggattttaa |
34866899 |
T |
|
| Q |
424 |
gagtggttcatgggttggattgcggtgctttggggtgagcttttgggtggtagtttaggttgtgtggtggtggtgatgt |
502 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34866898 |
gagtggttcatggattggattgcggtgctttggggtgagcttttgggtggtagtttaggttgtgtggtggtggtgatgt |
34866820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 468 - 502
Target Start/End: Complemental strand, 16511103 - 16511069
Alignment:
| Q |
468 |
gggtggtagtttaggttgtgtggtggtggtgatgt |
502 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
16511103 |
gggtggcagtttaggttgtgtggtggtggtgatgt |
16511069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University