View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8909_low_13 (Length: 439)
Name: NF8909_low_13
Description: NF8909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8909_low_13 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 8e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 282 - 439
Target Start/End: Complemental strand, 42092154 - 42091997
Alignment:
| Q |
282 |
aaagagagaacagtagaaaattaccgttgagtaaagtgaagatcaaaaggagatttgaatgaggaagtgacaagaggctgtgaagaaatagaaggaaaag |
381 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42092154 |
aaagagagaagagtagaaaattaccgttcagtaaagtgaagatcaaaaggagatttgaatgaggaagtgacaagaggctgtgaagaaatagaagacaaag |
42092055 |
T |
|
| Q |
382 |
cagagaaagaccccctgccattactagtgggtgtgggaagttccacaggctttcttga |
439 |
Q |
| |
|
|||||||||| || | |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42092054 |
cagagaaagatccaccgccattactagttggtgtgggaagttccacaggctttcttga |
42091997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 44 - 172
Target Start/End: Complemental strand, 42092290 - 42092162
Alignment:
| Q |
44 |
atgacaagtacttcttagaaatttaatctttactaaactcattaactactagaaaatcatccacttgattaaaacaaagctactagtagcagtattttat |
143 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092290 |
atgagaagtacttcttagaaatataatctttactaaactcattaactactagaaaatcatccacttgattaaaacaaagctactagtagcagtattttat |
42092191 |
T |
|
| Q |
144 |
ttcgttacaagtcaaaaataaaatgatta |
172 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42092190 |
ttcgttacaagtcaaaaataaaatgatta |
42092162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University