View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8909_low_28 (Length: 347)
Name: NF8909_low_28
Description: NF8909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8909_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 133 - 329
Target Start/End: Complemental strand, 24244444 - 24244250
Alignment:
| Q |
133 |
gaatattatggggaagacgcaattgagacattggttgttcggcatcgccgtatattgtccttttgcacatacatcggcagagtgttagccccaatcacct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24244444 |
gaatattatggggaagacgcaattgagacattggtttttcggcatcgccgtattttgtccttttgcacatacatcggcagagtgttagcaccaatcacct |
24244345 |
T |
 |
| Q |
233 |
aaattacagacaaagacaattatttttgtgnnnnnnnnnnnnggaaagaaatatgtttgtgttcttatatgggtttgcagagaccctttctctggaa |
329 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24244344 |
aaattacagacaaagacaattatgtttgtg--ttttttttttggaaagaaatatgtttgtgttcttatatgggtttgcagagaccctttctctggaa |
24244250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 24244569 - 24244471
Alignment:
| Q |
1 |
acaacgtgtagaacccagaagacagaaattgaattgagaattgagaatggttgaaggttagaattgatatcgatgaagttggaacgatgtagttgtgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24244569 |
acaacgtgtagaacccagaagacagaaattgaattgagaat-------ggttgaaggttagaattgatatcgatgaagttggaacgatgtagttgtgaaa |
24244477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University