View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8909_low_39 (Length: 274)
Name: NF8909_low_39
Description: NF8909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8909_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 15 - 255
Target Start/End: Original strand, 32681327 - 32681567
Alignment:
| Q |
15 |
cctgtgtgtgttactcttccgtgaatcaattcagattcttgttgtggattcttttcactttgcaattttcaaccatacaaattctctcactacccttcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32681327 |
cctgtgtgtgttactcttccgtgaatcaattcagattcttgttgtggattcttttcactttgcaattttcaaccatacaaattctctcactacccttcaa |
32681426 |
T |
 |
| Q |
115 |
tcttcagtttcattttcattctgttctgtttcccctgtttttcctctgttttgaattcaacccatcttttgattcctccaaaaattcaattcaaattttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32681427 |
tcttcagtttcattttcattctgttctgtttcccctgtttttcctctgttttgaattcaacccatcttttgattcctccaaaaattcaattcaaattttt |
32681526 |
T |
 |
| Q |
215 |
ggaggaattcaagaactgggttttgattttccgccaaatgg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32681527 |
ggaggaattcaagaactgggttttgattttccgccaaatgg |
32681567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University